Journal of Neuroimmunology Volume 119, Issue 2, Pages 343-349 October 1, 2001 URL: http://www.sciencedirect.com/science/journal/01655728 LPS-induced IL-10 production in whole blood cultures from chronic fatigue syndrome patients is increased but supersensitive to inhibition by dexamethasone ---------------------------------------------------------------------------------- Jeroen Visser(a,b,1), Willy Graffelman(c), Bep Blauw(a), Inge Haspels(a), Eef Lentjes(d), E. Ronald de Kloet(b) and Lex Nagelkerken(a) a Division of Immunological and Infectious Diseases, TNO Prevention and Health, P.O. Box 2215, 2301 CE, Leiden, The Netherlands b Division of Medical Pharmacology, Leiden Amsterdam Center for Drug Research, P.O. Box 9503, 2300 RA, Leiden, The Netherlands c Department of General Practice and Nursing Home Medicine, Leiden University Medical Center, P.O. Box 9600, 2300 RC, Leiden, The Netherlands d Department of Clinical Chemistry, Leiden University Medical Center, P.O. Box 9600, 2300 RC, Leiden, The Netherlands 1 Current address: Department of Medical Microbiology, Molecular Virology Section, University of Groningen, MWF Building 3211, A. Deusinglaan 1, 9713 AV, Groningen, The Netherlands. Corresponding author. Tel.: +31-715-181-398; fax: +31-715-181-901; email: am.nagelkerken@pg.tno.nl Received 17 April 2001; revised 17 July 2001; accepted 18 July 2001. Available online 27 September 2001. Abstract Several causes have been held responsible for the chronic fatigue syndrome (CFS), including an altered hypothalamus-pituitary-adrenal gland (HPA)-axis activity, viral infections and a reduced Th1 activity. Therefore, it was investigated whether the regulation of IL-10 is different in CFS. LPS-induced cytokine secretion in whole blood cultures showed a significant increase in IL-10 and a trend towards a decrease in IL-12 as compared with healthy controls. In patients and controls, IL-12 secretion was equally sensitive to suppression by dexamethasone, whereas IL-10 secretion appeared more sensitive in CFS-patients. In controls, IL-10 and IL-12 secretion were inversely correlated with free serum cortisol (r=-0.492, p<0.02 and r=-0.434, p<0.05, respectively). In CFS, such an inverse correlation was found for IL-12 (r=-0.611, p<0.02) but not for IL-10 (r=-0.341, ns). These data are suggestive for a disturbed glucocorticoid regulation of IL-10 in CFS. Author Keywords: Chronic fatigue syndrome; Glucocorticoids; IL-10; IL-12; TNF- alpha; Viral IL-10; Cortisol; Dexamethasone 1. Introduction The chronic fatigue syndrome (CFS) is a disease of unknown origin characterized by severe disabling fatigue with duration of more than 6 months and a reduction in normal daily activity of at least 50%. Several causes have been held responsible for the disease including viral infections, an altered immune function (Holmes; Fukuda; Bearn; Strauss and Komaroff) and a disturbed hypothalamus-pituitary-adrenal gland (HPA)-axis (Demitrack; Bearn and Komaroff). Several functional abnormalities of immune cells have been reported in CFS (Komaroff and Buchwald, 1998), which include a reduced DTH response, a decreased natural killer cell activity, a reduced mitogen response of lymphocytes and a reduced IFN-gamma production. We recently demonstrated that CD4+ T cells of CFS-patients produce less IFN-gamma (Visser et al., 1998a) These results are suggestive for a reduced Th1 activity in CFS, possibly as a consequence of dysregulation of IL-10 production or an involvement of viral IL-10. Viral IL-10 encoded by Epstein Barr virus (EBV) is highly homologous to human IL-10 and it down-regulates IL-12 and IFN-gamma production, as well as lymphocyte proliferation (Moore et al., 1993). Initially, Epstein Barr virus (EBV) has been held responsible for CFS although this possibility was rejected more recently (Strauss et al., 1994). Despite reactivation of some herpes viruses in individual CFS-patients (Ablashi et al., 2000), active or latent herpes virus infections did not show a relation with the syndrome in a well-defined patient-control study (Reeves and Swanink). CFS-patients show lower levels of free cortisol in urine and reduced evening plasma cortisol levels, in conjunction with elevated plasma levels of adrenocorticotropic hormone (ACTH) (Demitrack et al., 1991). Moreover, a challenge with corticotropin-releasing hormone (CRH) or ACTH resulted in a reduced integrated ACTH or cortisol response, respectively, in CFS-patients compared to controls. It is well established that glucocorticoids (GC) display a wide variety of immunosuppressive properties, ranging from the inhibition of T cell proliferation and cytokine production to the apoptosis of lymphocytes. Accordingly, our previous observation that lymphocytes from CFS-patients show an increased dexamethasone sensitivity may be explanatory for a reduced Th1 activity in these patients (Visser et al., 1998a). On the other hand, low concentrations of GC stimulate the production of IL-4 and the proliferation of human PBMC and T cell clones in vitro (Snijdewint et al., 1995), and enhance ovalbumin-specific IL-4 production in mice both in vivo and in vitro (Daynes and Araneo, 1989). Employing LPS-induced cytokine production in whole blood cultures (WBC) of healthy volunteers, we demonstrated that IL-10 synthesis is relatively resistant to GC, whereas IL-12 is highly sensitive to their suppressive effects (Visser et al., 1998b). Inasmuch as IL-10 and IL-12 play a central role in immunoregulation, we addressed the possibility that an altered sensitivity of these cytokines to GC is key to the observed immunological abnormalities in CFS. LPS-stimulated whole blood cultures (WBC, largely reflecting the activity of monocytes) from CFS-patients and controls were employed to study IL-10 and IL-12 at the protein and mRNA level, and to establish their sensitivity to dexamethasone. 2. Materials and methods 2.1. Subjects Patients between 18 and 50 years of age fulfilled the CDC-criteria as defined by Fukuda et al. (1994), i.e. they suffered from severe fatigue for more than 6 months resulting in a reduction of their daily activity by more than 50%. Patients were included if more than four of the following symptoms were present with a duration of at least 6 months: (1) impaired memory or concentration, (2) sore throat, (3) tender cervical or axillary lymph nodes, (4) muscle pain, (5) multi-joint pain, (6) new headaches, (7) unrefreshing sleep, and (8) post-exertion malaise. Patients suffering from somatic and psychiatric disorders and patients using beta-blockers, psychotropic drugs, immunosuppressive drugs or diuretics were excluded from the study. Also, patients with an alcohol intake of more than four units of alcohol per day and a body-mass index greater than 45 were excluded. Patients were recruited by 38 general practitioners associated with the Department of General Practice and Nursing Home Medicine, Leiden University Medical Center (LUMC). By inspection of the available medical records, it was established whether the prospective patients met the above-defined criteria. >From 66 patients that were requested to participate in this study, 59 patients gave their informed consent. These patients had been examined extensively by their general practitioner and/or specialist; there were no indications to make MRI-scans. The patients did not indicate a family history of MS to their general practitioner or in response to a questionnaire. The patients were requested to recruit a non-fatigued healthy control matched for age, race and sex from their direct environment, but not belonging to their household; 39 patients succeeded in recruiting such a control. Seventeen additional sex- and age-matched controls were selected by the general practitioners from the same practice as the patients. Two controls (one because of fatigue complaints and one because of medication) were excluded from this study. All controls gave informed consent. The mean age of the CFS-patients and the healthy controls was 38 p/m 8 years and 38 p/m 9 years, respectively. The female to male ratio in both groups was 2 to 1. Fasting blood samples of each patient and its matched control were simultaneously obtained at the patients home address between 7 and 10 a.m. This study was approved by the Medical Ethical Committee of the Leiden University Medical Center. 2.2. Antibodies and reagents Anti-IL-12 mAb C11.79, C8.6 and 20C2 were kindly provided by Dr. T van der Pouw Kraan (Central Laboratory of the Netherlands Red Cross Blood Transfusion Service, Amsterdam, The Netherlands), and Dr. D.H. Presky (Hoffmann-La Roche, Nutley, NJ). These antibodies recognize both IL-12p40 and the bioactive heterodimer p70, consisting of p40 and p35 as previously described (D'Andrea et al., 1995). Anti-IL-10 mAb (JES3-9D7 and biotinylated JES3-12G8), biotinylated anti-viral IL-10 JES3-6B11, anti-human TNF-alpha mAb (MAb1 and biotinylated Mab11) were purchased from Pharmingen (San Diego, CA). Recombinant human IL-12 was purchased from R&D Systems (Abington, UK), recombinant human IL-10 was kindly provided by Dr. S. Narula (Schering Plough Research Institute, Kenilworth, NJ), recombinant viral IL-10 and recombinant human TNF-alpha were obtained from Pharmingen. The glucocorticoid-receptor antagonist RU486 (Roussel-UCLAF, Romaineville, France) was a kind gift of Dr. Win Sutanto (Division of Medical Pharmacology, LACDR, Leiden, The Netherlands). Dexamethasone (DEX) was purchased from Sigma (St. Louis, MO). 2.3. Phenotypic analysis of white blood cells from CFS-patients and controls Forty microliters of whole blood was incubated with a saturating amount of fluorescein-isothiocyanate (FITC), phycoeryhtrin (PE) or Peridinin chlorophyll protein (PercP)-conjugated mAbs. Anti-CD3-FITC, anti-CD4-PercP, anti-CD8-PE, anti-CD14-FITC, anti-CD16-FITC and anti-CD19-FITC were obtained from Becton Dickinson (Mountain View, CA); anti-CD45RA-PE, anti-CD45RO-FITC, and anti-CD56-PE were obtained from CLB (Amsterdam, The Netherlands). Erythrocytes were lysed with FACS lysing solution (Becton Dickinson) according to the manufacturers description. After washing the cells with PBS, they were fixated with 0.5% formaldehyde. Cells were analyzed with the use of a FACScan (Becton Dickinson). As depicted in Table 1, extensive flowcytometric analysis of the whole blood cells revealed no major differences between patients and controls with the exception of a slight increase in the fraction of CD45RA+ CD4+ T cells in CFS-patients (p<0.05). 2.4. Cytokine secretion in LPS-stimulated whole blood cultures WBC were performed under suboptimal conditions to enable both stimulatory and inhibitory effects of DEX as described previously (Visser et al., 1998b). Cells were stimulated with 250 ng/ml LPS (Escherichia coli serotype 0127:B8, Sigma) to induce the secretion of IL-10, TNF-alpha and IL-12p40 by monocytes; IL-12p70 secretion was induced by stimulation with 250 ng/ml LPS in the presence of 1000 IU/ml IFN-gamma (a kind gift of Dr. Peter van der Meide, Biomedical Primate Research Center, Rijswijk, The Netherlands). Culture supernatants were harvested after 24 h of culture and stored at -20 C. Cytokine measurements were performed by ELISA as described previously (Visser et al., 1998b). For the detection of viral IL-10, ELISA-plates were coated with JES3-9D7 mAb (1 mug/ml), which captures both human and viral IL-10, and biotinylated JES3-6B11 mAb (2 mug/ml), which detects viral IL-10 only. For the detection of total IL-10 (human+viral IL-10), we used biotinylated JES3-12G8 as detecting antibody; in this assay, human IL-10 and viral IL-10 are interchangeable. Recombinant viral IL-10 or human IL-10 serially diluted in culture medium (range 10 to 2500 pg/ml) were used as standards. 2.5. Cortisol measurement Blood from the patients and the controls was collected, immediately put on ice and allowed to coagulate. The tubes were centrifuged (30 min, 3000 rpm, 4 C); serum was collected and immediately stored at -20 C. Total cortisol was measured using a fluorescent polarization immunoassay (Abbott, Amstelveen, The Netherlands). Free cortisol concentrations were measured in the filtrate obtained by temperature-controlled ultrafiltration using a MPS-1 ultrafiltration device (Amicon, Cherry Hill Drive, Beverly, MA) as described previously (Lentjes et al., 1997). 2.6. Semi-quantitative PCR PBMC were isolated from heparin blood by Ficoll-Isopaque (Histopaque-1077, Sigma) density centrifugation. Remaining erythrocytes were lyzed with the use of a lyzing solution (Becton Dickinson) according to the manufacturer's instructions. RNA was extracted from the PBMC employing RNAzol B according to the manufacturers instructions (Biotex laboratories, Houston, TX) and used to measure IL-10, IL-12p35, IL-12p40 and IFN-gamma mRNA in a semi-quantitative manner employing PQB-3 and PQA-1 vectors as external standards as described previously (Visser et al., 1998b). To prepare a standard for vIL-10, RNA was isolated from EBV transformed B cell lines both in the lytic and latent phase of infection and reverse transcribed into cDNA. Viral IL-10 cDNA was amplified by PCR using the following primers: sense, TGTGGAGGTACAGACCAATGT; antisense, CACCTGGCTTTAATTGTCATG. PCR products were separated on 1% agarose gels and stained with ethidium bromide or SYBR Green I (Biozym, Landgraaf, The Netherlands), after which densities of the product bands were determined using the Bio-1D digital imaging system version 6 (Vilber Lourmat, Marne La Vallee, France). Subsequently, the amount of product was expressed in femtograms with the use of a calibration curve. Results are expressed as a ratio of quantified cytokine product (fg) to beta-actin product (fg). 2.7. Data processing and statistics The curve-fitting option in the Biorad microplatemanager software was applied to calculate the cytokine concentrations in the supernatants. Statistical analysis was performed using the rank Wilcoxon test for matched pairs. Correlations were tested using the non-parametric Spearman correlation test. Differences with a confidence level of 95% or higher were considered to be statistically significant (p<0.05). 3. Results 3.1. Increased IL-10 and decreased IL-12 secretion in WBC of CFS-patients Previous experiments performed with purified CD4+ T cells of CFS-patients revealed a decreased IFN-gamma secretion in response to PHA-stimulation (Visser et al., 1998a). Inasmuch as IL-10 and IL-12 have been recognized as cytokines that inhibit or stimulate IFN-gamma production, respectively (Trinchieri, 1995), we studied the levels of these cytokines in plasma of CFS-patients; moreover, the secretion of these cytokines was studied in LPS-stimulated WBC to assess the functional capacity of the monocytes. We did not observe differences between patients and controls with respect to serum levels of IL-10, TNF-alpha or IFN-gamma, whereas IL-12p40 levels were below the detection limit of our assay (data not shown). However, as shown in Table 2, LPS-stimulated WBC of CFS-patients show an increased secretion of IL-10 (p<0.05) and a trend (p=0.07) towards a reduced secretion of IL-12p70 (in the presence of IFN-gamma. In contrast, no differences were found between patients and controls with regard to the secretion of IL-12p40 and TNF-alpha. Because the ELISA for IL-10 may also detect viral IL-10 encoded by Epstein Barr virus, we verified whether this could account for the increased IL-10 levels. However, we were unable to detect significant levels of such protein by a specific viral IL-10 ELISA in the supernatants of WBC in all tested patients and controls. To establish whether whole blood cells were also different with regard to their state of activation in vivo, we studied unstimulated PBMC from 20 randomly selected patients and 20 matched controls with regard to the expression of mRNA encoding a variety of cytokines by semi-quantitative RT-PCR. In patients and controls, the levels of IL-12p40 mRNA and viral IL-10 were below the detection limit of the assay; although mRNA for human IL-10, IL-12p35 and IFN-gamma was detectable, their levels did not differ between patients and controls (data not shown). Differences in IL-10 and IL-12p70 between patients and controls could not be attributed to differences in numbers of monocytes (see Table 1). Also, after correcting the data for the number of CD14+ monocytes, CFS-patients had on average more IL-10 (CFS: 93 p/m 12 fg/monocyte versus Controls: 65 p/m 9 fg/monocyte; rank Wilcoxon test, p<0.01) and less IL-12p70 (CFS: 8 p/m 1 fg/monocyte versus Controls: 14 p/m 2 fg/monocyte; rank Wilcoxon test, p<0.05). This suggests that monocytes of CFS-patients have an increased IL-10/IL-12 ratio, which in turn may be responsible for the reported decrease in IFN-gamma production. 3.2. Relation between cytokine secretion and endogenous cortisol levels Because whole blood contains autologous cortisol, and therefore, the monocytes are exposed to autologous cortisol, we addressed the possibility that the levels of secreted cytokines were a reflection of endogenous cortisol levels. Serum of the patients contained on average 0.68 p/m 0.26 muM total cortisol and 41.4 p/m 10 nM free cortisol; the average serum concentrations in the controls were not significantly different with 0.73 p/m 0.2 muM and 38.2 p/m 16.6 nM, respectively. As shown in Fig. 1, cytokine production in WBC of healthy controls was inversely related to the endogenous free cortisol levels. This was found for LPS-induced IL-10 and LPS+IFN-gamma induced IL-12p70. This suggests that in healthy controls these cytokines are under negative control of cortisol in a dose-dependent manner. In contrast, CFS-patients showed such a correlation only for IL-12 p70, whereas IL-10 secretion appeared independent of endogenous cortisol. 3.3. IL-10 production in LPS-stimulated WBC of CFS-patients is more sensitive to glucocorticoids Because CFS-patients are characterized by a mild hypofunctioning of their HPA-axis resulting in a blunted cortisol response (Demitrack and Scott), we anticipated that cytokine production by cells from patients may display a different sensitivity towards glucocorticoids in vitro. To address this possibility, we studied the secretion of cytokines in WBC in the presence of graded dosages of DEX. For each donor, we determined the concentration of DEX that would be required to achieve 50% inhibition of cytokine production (IC50) and subsequently calculated the mean IC50 of the tested donors for each individual cytokine. A value of 10 000 nM was assigned if extrapolation predicted that more than 10-5 M DEX would be needed to achieve 50% inhibition. As shown in Table 3, patients and controls were equally sensitive with regard to the suppression of TNF-alpha, IL-12p40 and IL-12 p70. However, LPS-induced IL-10 secretion in WBC of patients was more sensitive to the suppressive effect of DEX as compared to IL-10 secretion by WBC of controls (p<0.001). The suppression of cytokine production by DEX was mediated via the glucocorticoid receptor because the receptor antagonist RU486 completely abrogated this suppressive effect (data not shown). 4. Discussion One of the most consistent findings in CFS is a decrease in Th1-mediated immune responses (Strauss and Komaroff). Because the balance between IL-10 and IL-12 is a major determinant in the regulation of IFN-gamma production, these cytokines were studied in LPS-stimulated WBC of CFS-patients. Our data presented herein indicate that CFS-patients -as compared to healthy donors- have an increased secretion of LPS-induced IL-10 and a trend to a lower secretion of IL-12p70. Moreover, IL-10 secretion in WBC of CFS-patients appears more sensitive to dexamethasone. Most likely, the previously reported decrease in Th1 activity in CFS-patients is due to an increased IL-10/IL-12 ratio. At this stage, the cause of such an altered balance is uncertain. In view of the suggestion that CFS is preceded by an EBV infection and this virus encodes for a cytokine highly homologous to IL-10, we studied viral IL-10 by ELISA and PCR. However, we were unable to obtain evidence for an involvement of viral IL-10 inasmuch as this product could neither be detected at the protein, nor at the mRNA level. CFS-patients have been shown to display a disturbed HPA-axis and have low levels of cortisol (Demittrack et al., 1991). We could not confirm this, most likely because of a different study design. We measured the cortisol levels at only one time point; 24-h urinary cortisol levels would have been more informative in this regard. Nevertheless, we speculate that in these patients IL-10 and IL-12 are differently affected by glucocorticoids. We demonstrated previously in a different population of CFS-patients that their lymphocytes are more sensitive to the suppressive effect of DEX, both on the level of T cell proliferation and IL-4 production (Visser et al., 1998a). On the other hand, previous studies including our own have shown in healthy donors that pro-inflammatory cytokines are sensitive to the suppressive effects of GC, whereas anti-inflammatory cytokines are rather stimulated by GC. The present study shows that, in particular, IL-10 secretion (and its sensitivity to GC) in CFS differs from that in healthy controls. First, LPS-induced IL-10 secretion did not correlate with endogenous free cortisol levels. Whereas healthy controls with high levels of cortisol showed low levels of IL-10 secretion and controls with low cortisol levels showed high levels of IL-10 secretion, such an inverse correlation was not found in CFS. The fact that both CFS-patients and healthy donors did show such an inverse correlation with regard to IL-12 suggests that, in particular, IL-10 is subject to an altered HPA-axis in CFS. This finding extends a previous observation by Cannon et al. (1998), which showed the absence of a relation between endogenous cortisol and stress-induced neutrophil mobilization. Our observation that LPS-induced IL-10 is increased in CFS-patients is at odds with our finding that IL-10 secretion in CFS-patients is more sensitive to GC mediated suppression. Although the first observation is in line with the idea that cortisol levels are decreased in CFS (Demitrack et al., 1991) and our previous observation regarding a decrease in IFN-gamma production (Visser et al., 1998a), the second observation requires a more hypothetical interpretation. One of the possibilities is that lymphocytes and monocytes of CFS-patients show a different number and affinity of GC receptors. However, in a separate study, we showed that this was not the case (Visser et al., 2001). On the other hand, differences in number or affinity of the receptor would not have been explanatory for the fact that an altered sensitivity is found for IL-10 (this study) and IL-4 (Visser et al., 1998a), but not for IL-12, TNF- alpha and IFN-gamma. In addition, DEX-mediated suppression of IL-10 secretion was equally abrogated by the GC receptor antagonist RU 486 (data not shown). It may therefore be that the regulation of IL-10 by GC in CFS-patients is disturbed at the level of the transcription factors AP-1 and NFkB; these have been shown to represent targets in the suppressive effects of GC (Barnes; Scheinman and Auphan). On the other hand, because it has been demonstrated that CREB and AP-1 play a major role in IL-10 gene expression (Platzer et al., 1995), further investigation of these transcription factors in particular may reveal unique features that are explanatory for the observed immunological changes in CFS. The specificity of our findings for CFS remains to be established. It is, however, unlikely that our observations regarding an increased sensitivity to GC are due to endogenous depression: patients with depression show increased cortisol levels and a resistance to GC in vitro (Gormley and Modell). It is also unclear whether increased IL-10 levels are responsible for fatigue symptoms. Fatigue is a condition that is also associated with multiple sclerosis; however, MS patients show decreased IL-10 levels, in particular, during active disease (van Boxel-Dezaire et al., 1999). Moreover, a recent clinical trial in Crohn's disease did not show that IL-10 treatment was associated with fatigue complaints (Schreiber et al., 2000). Additional studies are needed to establish to what extent our observations contribute to more insight into the cause of the symptoms that are associated with CFS. In particular, further studies regarding IL-10 regulation by GC may help to gain insight into the underlying cause of this syndrome. Acknowledgements We thank Mrs. Arianne Plomp for providing us with the EBV transformed B cell lines. Furthermore, we would like to thank Dr. C. Lucas for critically reading the manuscript. Zorg Onderzoek Nederland financially supported this study, Grant number: 002829080. Tables Table 1. Phenotypic analysis of whole blood from CFS-patients and healthy controls ------------------------------------------------------------------------- CFS Controls N ------------------------------------------------------------------------- Leukocytes 10^6/ml 7.0 p/m 2.3 6.4 p/m 2.2 49 PMNL^a 55.8 p/m 2.0 56.2 p/m 2.0 49 CD3 + (T cells) 27.3 p/m 6.4 25.2 p/m 7.3 49 CD4 + (Th cells) 16.1 p/m 5.0 14.7 p/m 5.0 49 CD8 + (Tc cells) 6.9 p/m 2.5 7.2 p/m 2.9 46 CD14 + (monocytes) 5.3 p/m 1.6 5.6 p/m 1.5 48 CD19 + (B cells) 4.1 p/m 1.9 4.0 p/m 2.1 49 CD16 +/ CD56 + (NK cells) 5.1 p/m 5.0 4.2 p/m 2.1 49 CD45RA + within 39.9 p/m 12.4 32.2 p/m 11.0^b 49 CD4 (naive) CD45RO + within 35.2 p/m 10.2 38.9 p/m 12.0 49 CD4 (memory) ------------------------------------------------------------------------- a Polymorphonuclear leukocytes. Results are expressed as mean per- centages p/m SD of total nucleated cells. b Wilcoxon rank sum test for matched pairs, p < 0.05. Table 2. Mean cytokine levels in LPS-stimulated whole blood cultures of CFS-patients compared to age- and sex-matched controls ------------------------------------------------------------------------- Cytokine^a CFS Controls N p^b ------------------------------------------------------------------------- IL-10^c 276 p/m 27 209 p/m 27 48 0.047 vIL-10^c <10 <10 48 - IL-12p70^d 113 p/m 14 162 p/m 19 29 0.074 IL-12p40^c 1087 p/m 24 978 p/m 100 43 ns TNF-alpha^c 2137 p/m 528 1222 p/m 85 35 ns ------------------------------------------------------------------------- a Results are expressed in pg/ml p/m SEM. b Wilcoxon rank sum test for matched pairs; ns = not significant. c Whole blood stimulated with 0.25 mug/ml LPS. d Whole blood stimulated with 0.25 mug/ml LPS + 1000 IU/ml IFN-gamma. Table 3. Increased sensitivity of LPS-induced IL-10 secretion to dexamethasone in whole blood cultures from CFS-patients ------------------------------------------------------------------------- Cytokine IC50 (nM) p/m SEM N p^a ----------------------------- CFS Controls ------------------------------------------------------------------------- IL-10^b 3159 p/m 643 5536 p/m 647 48 0.001 TNF-alpha^b 42 p/m 12 38 p/m 7 35 ns IL-12p40^b 141 p/m 43 145 p/m 44 43 ns IL-12p70^c 59 p/m 20 29 p/m 8 15 ns ------------------------------------------------------------------------- a Wilcoxon rank sum test for matched pairs; ns = not significant. b Whole blood stimulated with 0.25 mug/ml LPS. c Whole blood stimulated with 0.25 mug/ml LPS + 1000 IU /ml IFN-gamma. Figure caption Fig. 1. IL-10 secretion in whole blood cultures of CFS-patients is not related to endogenous free cortisol. Whole blood was stimulated with 0.25 mug/ml LPS for IL-10 (top) or with 0.25 mug/ml LPS+1000 IU/ml IFN-gamma for IL-12p70 (bottom). Cytokines were determined in the supernatants collected after 24 h of culture by ELISA. Endogenous serum-free cortisol was established as described in the Materials and methods. Closed symbols represent CFS-patients and open symbols age- and sex-matched controls. The correlation coefficient and statistical significance were calculated according to the method of Spearman. Controls. IL-10: n=23, r=-0.492, p<0.02; IL-12p70: n=22, r=-0.434, p<0.05. CFS. IL-10: n=20, r=-0.341, p=NS; IL-12p70: n=18, r=-0.611, p<0.02. References Ablashi et al., 2000D.V. Ablashi, H.B. Eastman, C.B. Owen, M.M. Roman, J. Friedman, J.B. Zabriskie, D.L. Peterson, G.R. Pearson and J.E. Whitman , Frequent HHV-6 reactivation in multiple sclerosis (MS) and chronic fatigue syndrome (CFS) patients. J. Clin. Virol. 16 (2000), pp. 179-191. Auphan et al., 1995N. Auphan, J.A. Di Donato, C. Rosette, A. Helmberg and M. Karin , Immunosuppression by glucocorticoids: Inhibition of NF-kB activity through induction of IkB synthesis. Science 270 (1995), pp. 286-290. Barnes et al., 1995P.J. Barnes, A.P. Greening and G.K. Crompton , Glucocorticoid resistance in asthma. Am. J. Respir. Crit. Care Med. 152 (1995), pp. s125-142. Bearn and Wessely, 1994J. Bearn and S. Wessely , Neurobiological aspects of the chronic fatigue syndrome. Eur. J. Clin. Invest. 24 (1994), pp. 79-90. Cannon et al., 1998J.G. Cannon, J.B. Angel, L.W. Abad, J. O'Grady, N. Lundgren, L. Fagioli and A.L. Komaroff , Hormonal influences on stress-induced neutrophil mobilization in health and chronic fatigue syndrome. J. Clin. Immunol. 18 4 (1998), pp. 291-298. D'Andrea et al., 1995A. D'Andrea, M. Aste-Amezaga, N.M. Valiante, X. Ma, M. Kubin and G. Trinchieri , Interleukin 10 inhibits human lymphocyte interferon production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells. J. Exp. Med. 178 (1995), pp. 1041-1048. Daynes and Araneo, 1989R.A. Daynes and B.A. Araneo , Contrasting effects of glucocorticoids on the capacity of T cells to produce growth factors interleukin-2 and interleukin-4. Eur. J. Immunol. 19 (1989), pp. 2319-2325. Demitrack et al., 1991M.A. Demitrack, J.K. Dale, S.E. Strauss, L. Laue, S.J. Listwak, M.J. Kruesi, G.P. Chrousos and P.W. Gold , Evidence for impaired activation of the hypothalamic-pituitary-adrenal axis in patients with chronic fatigue syndrome. J. Clin. Endocrinol. Metab. 73 (1991), pp. 1224-1234. Fukuda et al., 1994K. Fukuda, S.E. Strauss, I. Hickie, M.C. Sharpe, J.G. Dobbins and A. Komaroff , The chronic fatigue syndrome: a comprehensive approach to its definition and study. Ann. Intern. Med. 121 (1994), pp. 953-959. Gormley et al., 1985G.J. Gormley, M.T. Lowy, A.T. Reder, V.D. Hospelhorn, J.P. Antel and H.Y. Meltzer , Glucocorticoids in depression: relationship to the dexamethasone suppression test. Am. J. Psychiatry 142 (1985), pp. 1278-1284. Holmes et al., 1988G.P. Holmes, J.E. Kaplan, N.M. Gantz, A.L. Komaroff, L.B. Schonberger, S.E. Straus, J.F. Jones, R.E. Dubois, C. Cunningham-Rundles and S. Pahwa , Chronic fatigue syndrome: a working case definition. Ann. Intern. Med. 108 (1988), pp. 387-389. Komaroff and Buchwald, 1998A.L. Komaroff and D.S. Buchwald , Chronic fatigue syndrome: an update. Annu. Rev. Med. 49 (1998), pp. 1-13. Lentjes et al., 1997E.G.W.M. Lentjes, E.N. Griep, J.W. Boersma, F.P.T.H.M. Romijn and E.R. de Kloet , Glucocorticoid receptors, fibromyalgia and low back pain. Psychoneuroendocrinology 22 8 (1997), pp. 603-614. Modell et al., 1997S. Modell, A. Yassouridis, J. Huber and F. Holsboer , Corticosteroid receptor function is decreased in depressed patients. J. Neuroendocrinol. 65 3 (1997), pp. 216-222. Moore et al., 1993K.W. Moore, A. O'garra, R. de Waal Malefyt, P. Vieira and T.R. Mosmann , Interleukin 10. Annu. Rev. Immunol. 11 (1993), pp. 165-190. Platzer et al., 1995C. Platzer, Ch. Meisel, K. Vogt, M. Platzer and H.D. Volk, Upregulation of monocytic IL-10 by tumor necrosis factor-alpha and cAMP elevating drugs. Int. Immunol. 4 (1995), p. 517. Reeves et al., 2000W.C. Reeves, F.R. Stamey, J.D. Black, A.C. Mawle, J.A. Stewart and P.E. Pellet , Human herpesviruses 6 and 7 in chronic fatigue syndrome: a case-control study. Clin. Infect. Dis. 31 (2000), pp. 48-52. Scheinman et al., 1995R.I. Scheinman, P.C. Cogswell, A.K. Lofquist and A.S. Baldwin, Jr. , Role of transcriptional activation of IkBalpha in mediation of immunosuppression by glucocorticoids. Science 270 (1995), pp. 283-286. Schreiber et al., 2000S. Schreiber, R. Fedorak, O. Nielsen, G. Wild, C. Williams, S. Nikolaus, M. Jacyna, B. Lashner, A. Gangl, P. Rutgeerts, K. Isaacs, S. van Deventer, J. Koningsberger, M. Cohard, A. LeBaut and S. Hanauer, Safety and efficacy of recombinant human interleukin 10 in chronic active Chrohn's disease. Gastroenterology 119 (2000), pp. 1461-1472. Scott et al., 1998L.V. Scott, S. Medbak and T.G. Dinan , The low dose ACTH test in chronic fatigue syndrome and health. Clin. Endocrinol. 48 (1998), pp. 733-737. Snijdewint et al., 1995F.G.M. Snijdewint, M.L. Kapsenberg, P.J.J. Wauben-Penris and J.D. Bos , Corticosteroids class-dependently inhibit Th1- and Th2-type cytokine production. Immunopharmacology 29 (1995), pp. 93-101. Strauss et al., 1994S.E. Strauss, A.L. Komaroff and H.J. Wedner , Chronic fatigue syndrome: point and counterpoint. J. Infect. Dis. 170 (1994), pp. 1-6. Swanink et al., 1995C.M.A. Swanink, J.H.M.M. Vercoulen, G. Bleijenberg, J.F.M. Fennis, J.M.D. Galema and J.W. van der Meer , Chronic Fatigue Syndrome: a clinical and laboratory study with a well matched control group. J. Intern. Med. 237 (1995), pp. 499-506. Trinchieri, 1995G. Trinchieri , Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen specific adaptive immunity. Annu. Rev. Immunol. 13 (1995), pp. 251-276. van Boxel-Dezaire et al., 1999A.H.H. van Boxel-Dezaire, S.C.J. Hoff, B.W. van Oosten, C.L. Verweij, A.M. Drager, H.J. Ader, J.C. van Houwelingen, F. Barkhof, C.H. Polman and L. Nagelkerken , Decreased IL-10 and increased IL-12p40 mRNA are associated with disease activity and characterize different disease stages in multiple sclerosis. Ann. Neurol. 45 6 (1999), pp. 695-703. Visser et al., 1998aJ. Visser, B. Blauw, B. Hinloopen, E. Brommer, E.R. de Kloet, C. Kluft and L. Nagelkerken , CD4 T lymphocytes from patients with chronic fatigue syndrome have decreased interferon-gamma production and increased sensitivity to dexamethasone. J. Infect. Dis. 177 (1998), pp. 451-454. Visser et al., 1998bJ. Visser, A. van Boxel-Dezaire, D. Methorst, T. Brunt, E.R. de Kloet and L. Nagelkerken , Differential regulation of Interleukin-10 (IL-10) and IL-12 by glucocorticoids in vitro. Blood 91 11 (1998), pp. 4255-4264. Visser et al., 2001J. Visser, E. Lentjes, I. Haspels, W. Graffelman, B. Blauw, R. de Kloet and L. Nagelkerken , Increased sensitivity to glucocorticoids in peripheral blood mononuclear cells of chronic fatigue syndrome patients, without evidence for altered density or affinity of glucocorticoid receptors. J. Investig. Med. 49 (2001), pp. 195-204. -------- (c) 2001 Elsevier Science B.V.